Zoological Research ›› 2019, Vol. 40 ›› Issue (3): 205-210.doi: 10.24272/j.issn.2095-8137.2019.037

• Articles • Previous Articles     Next Articles

Purification and characterization of a novel anti-coagulant from the leech Hirudinaria manillensis

Ruo-Mei Cheng1,Xiao-Peng Tang2,3,Ai-Lin Long2,3,James Mwangi2,Ren Lai2,Rui-Pu Sun4,Cheng-Bo Long2(),Zhen-Qing Zhang1()   

  1. 1. Department of Pharmaceutical Sciences, College of Pharmaceutical Sciences, Soochow University, Suzhou Jiangsu 215123, China
    2. Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese Academy of Sciences/Key Laboratory of Bioactive Peptides of Yunnan Province, Kunming Institute of Zoology, Kunming Yunnan 650223, China
    3. Kunming College of Life Science, University of Chinese Academy of Sciences, Kunming Yunnan 650204, China
    4. Jiangxi Medical College, Nanchang University, Nanchang Jiangxi 330006, China
  • Received:2018-09-03 Accepted:2019-01-07 Online:2019-05-18 Published:2019-04-19
  • Contact: Cheng-Bo Long,Zhen-Qing Zhang E-mail:longchengbo@mail.kiz.ac.cn
  • Supported by:
    This work was supported by the National Natural Science Foundation of China (21761142002, 81770464), Ministry of Science and Technology of China (2018ZX09301043-003), Chinese Academy of Sciences (QYZDJ-SSW-SMC012, SAJC201606), West Light Foundation and Youth Innovation Promotion Association (2017432), and Yunnan Provincial Science and Technology Department (2017FB038, 2015BC005)

Abstract:

Protease inhibitors have been reported rarely from the leech Hirudinaria manillensis. In this study, we purified a novel protease inhibitor (bdellin-HM-2) with anticoagulant properties from H. manillensis. With a molecular weight of 1.4x104, bdellin-HM-2 was also characterized with three intra-molecular disulfide bridges at the N-terminus and multiple HHXDD and HXDD motifs at the C-terminus. cDNA cloning revealed that the putative nucleotide-encoding protein of bdellin-HM-2 contained 132 amino acids and was encoded by a 399 bp open reading frame (ORF). Sequence alignment showed that bdellin-HM-2 shared similarity with the “non-classical” Kazal-type serine protease inhibitors, but had no inhibitory effect on trypsin, elastase, chymotrypsin, kallikrein, factor XIIa (FXIIa), factor XIa (FXIa), factor Xa (FXa), thrombin, or plasmin. Bdellin-HM-2 showed anticoagulant effects by prolonging the activated partial thromboplastin time (aPTT), indicating a role in enabling H. manillensis to obtain a blood meal from its host. Our results suggest that bdellin-HM-2 may play a crucial role in blood-sucking in this leech species and may be a potential candidate for the development of clinical anti-thrombotic drugs.

Key words: Hirudinaria manillensis, Bdellin-HM-2, “Non-classical” Kazal inhibitors, Blood sucking, Anticoagulant, Anti-thrombotic drugs

Table 1

Primers used for cDNA cloning of bdellin-HM-2"

Primer Sequence (5'–3')
1 AACAGGTTTGCGGAAGT
2 AAGCAGTGGTATCAACGCAGAGT
3 AATTCCAGGGTACAGACG
4 ATTCTAGAGGCCGAGGCGGCCGA

Figure 1

Purification of bdellin-HM-2 from H. manillensis "

Figure 2

cDNA sequence encoding bdellin-HM-2 precursor and sequence alignment with other protease inhibitors"

Figure 3

Effects of bdellin-HM-2 on aPTT"

Figure 4

Bdellin-HM-2 had no effect on proteases"

Ali MF , Lips KR , Knoop FC , Fritzsch B , Miller C , Conlon JM . 2002. Antimicrobial peptides and protease inhibitors in the skin secretions of the crawfish frog, Rana areolata . Biochimica et Biophysica Acta-Proteins and Proteomics, 1601(1): 55–63.
Birrell GW , Earl STH , Wallis TP , Masci PP , De Jersey J , Gorman JJ , Lavin MF . 2007. The diversity of bioactive proteins in Australian snake venoms. Molecular & Cellular Proteomics, 6(6): 973–986.
Bode W , Huber R . 1992. Natural protein proteinase inhibitors and their interaction with proteinases. European Journal of Biochemistry, 204(2): 433–451.
De Marco R , Lovato DV , Torquato RJS , Clara RO , Buarque DS , Tanaka AS . 2010. The first pacifastin elastase inhibitor characterized from a blood sucking animal. Peptides, 31(7): 1280–1286.
Dodt J . 1995. Anticoagulatory substances of bloodsucking animals: from hirudin to hirudin mimetics. Angewandte Chemie-International Edition, 34(8): 867–880.
Eigenbrot C , Ultsch M , Lipari MT , Moran P , Lin SJ , Ganesan R , Quan C , Tom J , Sandoval W , Van Lookeren Campagne M , Kirchhofer D . 2012. Structural and functional analysis of HtrA1 and its subdomains. Structure, 20(6): 1040–1050.
Fink E , Rehm H , Gippner C , Bode W , Eulitz M , Machleidt W , Fritz H . 1986. The primary structure of Bdellin B-3 from the leech Hirudo Medicinalis - Bdellin B-3 is a compact proteinase inhibitor of a “Non-classical” Kazal Type - It is present in the leech in a high molecular mass form. Biological Chemistry Hoppe-Seyler, 367(12): 1235–1242.
Gupta R , Brunak S . 2002. Prediction of glycosylation across the human proteome and the correlation to protein function. Pacific Symposium on Biocomputing, 7(3): 310–322.
Hong SJ , Kang KW . 1999. Purification of granulin-like polypeptide from the blood-sucking leech, Hirudo nipponia . Protein Expression and Purification, 16(2): 340–346.
Kim YH , Choi JG , Lee GM , Kang KW . 2001. Domain and genomic sequence analysis of bdellin-KL, a leech-derived trypsin-plasmin inhibitor. Journal of Biochemistry, 130(3): 431–438.
Kim JY , Park SC , Hwang I , Cheong H , Nah JW , Hahm KS , Park Y . 2009. Protease inhibitors from plants with antimicrobial activity. International Journal of Molecular Sciences, 10(6): 2860–2872.
Lai Y , Li B , Liu W , Wang G , Du C , Ombati R , Lai R , Long C , Li H . 2016. Purification and characterization of a novel Kazal-type trypsin inhibitor from the leech of Hirudinaria manillensis . Toxins, 8(8): 229–239.
Laskowski M , Jr, Kato I . 1980. Protein inhibitors of proteinases. Annual Review of Biochemistry, 49: 593–626.
Leung D , Abbenante G , Fairlie DP . 2000. Protease inhibitors: current status and future prospects. Journal of Medicinal Chemistry, 43(3): 305–341.
Mägert HJ , Ständker L , Kreutzmann P , Zucht HD , Reinecke M , Sommerhoff CP , Fritz H , Forssmann WG . 1999. LEKTI, a novel 15-domain type of human serine proteinase inhibitor. Journal of Biological Chemistry, 274(31): 21499–21502.
Markwardt F . 1996. State-of-the-Art Review: Antithrombotic agents from hematophagous animals. Clinical and Applied Thrombosis-Hemostasis, 2(2): 75–82.
Markwardt F . 2002. Hirudin as alternative anticoagulant-a historical review. Seminarsin Thrombosis and Hemostasis, 28(5): 405–413.
Mende K , Petoukhova O , Koulitchkova V , Schaub GA , Lange U , Kaufmann R , Nowak G . 1999. Dipetalogastin, a potent thrombin inhibitor from the blood-sucking insect Dipetalogaster maximus-cDNA cloning, expression and characterization. European Journal of Biochemistry, 266(2): 583–590.
Moser M , Auerswald E , Mentele R , Eckerskorn C , Fritz H , Fink E . 1998. Bdellastasin, a serine protease inhibitor of the antistasin family from the medical leech (Hirudo medicinalis) - primary structure, expression in yeast, and characterisation of native and recombinant inhibitor. European Journal of Biochemistry, 253(1): 212–220.
Ohtsubo K , Marth JD . 2006. Glycosylation in cellular mechanisms of health and disease. Cell, 126(5): 855–867.
Rimphanitchayakit V , Tassanakajon A . 2010. Structure and function of invertebrate Kazal-type serine proteinase inhibitors. Developmental & Comparative Immunology, 34(4): 377–386.
Ryan CA . 1990. Protease inhibitors in plants-genes for improving defenses against insects and pathogens. Annual Review of Phytopathology, 28: 425–449.
Sabotic J , Kos J . 2012. Microbial and fungal protease inhibitors-current and potential applications. Applied Microbiology and Biotechnology, 93(4): 1351–1375.
Salzet M . 2001. Anticoagulants and inhibitors of platelet aggregation derived from leeches. FEBS Letters, 492(3): 187–192.
Salzet M , Chopin V , Baert JL , Matias I , Malecha J . 2000. Theromin, a novel leech thrombin inhibitor. Journal of Biological Chemistry, 275(40): 30774–30780.
Shadrin N , Shapira MG , Khalfin B , Uppalapati L , Parola AH , Nathan I . 2015. Serine protease inhibitors interact with IFN-γ through up-regulation of FasR; a novel therapeutic strategy against cancer. Experimental Cell Research, 330(2): 233–239.
Strube KH , Kröger B , Bialojan S , Otte M , Dodt J . 1993. Isolation, sequence-analysis, and cloning of Haemadin - an anticoagulant peptide from the Indian leech. Journal of Biological Chemistry, 268(12): 8590–8595.
Supuran CT , Scozzafava A , Clare BW . 2002. Bacterial protease inhibitors. Medicinal Research Reviews, 22(4): 329–372.
Tuszynski GP , Gasic TB , Gasic GJ . 1987. Isolation and characterization of antistasin -an inhibitor of metastasis and coagulation. Journal of Biological Chemistry, 262(20): 9718–9723.
Van De Locht A , Lamba D , Bauer M , Huber R , Friedrich T , Kröger B , Höffken W , Bode W . 1995. Two heads are better than one: crystal structure of the insect derived double domain Kazal inhibitor rhodniin in complex with thrombin. EMBO Journal, 14(21): 5149–5157.
Vicuña L , Strochlic DE , Latremoliere A , Bali KK , Simonetti M , Husainie D , Prokosch S , Riva P , Griffin RS , Njoo C , Gehrig S , Mall MA , Arnold B , Devor M , Woolf CJ , Liberles SD , Costigan M , Kuner R . 2015. The serine protease inhibitor SerpinA3N attenuates neuropathic pain by inhibiting T cell-derived leukocyte elastase. Nature Medicine, 21(5): 518–523.
Wang LJ , Gao GF , Bai SP , Liu ZG , Liang JG , Zhang KY , Lai R . 2005. A thrombin inhibitor from ixodid tick, Ixodide sinesis . Zoological Research, 26(3): 328–331.
Zhang Y . 2006. Amphibian skin secretions and bio-adaptive significance- implications from Bombina maxima skin secretion proteome. Zoological Research, 27(1): 101–112.
[1] ZHAO Hua-fu,LIU Jia,HU Jian. An Improved Method on Encapsulation Assays by Larval Hemocytes from Ostrinia furnacalis in vitro [J]. Zoological Research, 2007, 28(6): 675-680.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
[1] ZHENG Ping-ping,CHEN Wen,LI Jie,RUI Jin-long,NIE Liu-wang *. Construction of a cDNA Library from the Testis and Sequence Analysis of the Ubiquitin Gene from Rana nigromaculata (in English)[J]. Zoological Research, 2007, 28(1): 9 -16 .
[2] ZHOU Wei*,PAN Xiao-fu,OU Xiao-hong,ZHANG Qing. Comparison of Food Components Between Rana pleuraden and Rana chaochiaoensis from Kunming and Evaluation of Their Benefit and Harm[J]. Zoological Research, 2007, 28(1): 28 -34 .
[3] PAN Pu-liang,WANG Hong,N.G.Jablonski. Long Bone and Skeletal Allometry in Rhinopithecus[J]. Zoological Research, 1989, 10(1): 23 -30 .
[4] XIONG Yu-liang,WANG Wan-yu,YANG Chang-jin,TIEN Yun-fen. Inhibitory Effects of The Elapidae Venoms in The Mice's Sarcoma 180 Ehrilich Ascititers Carcenoma[J]. Zoological Research, 1989, 10(1): 31 -35 .
[5] ZHU Shi-mo,HUANG Fi-sheng. Effect of Geological Vicissitude on Orignation of Termite from Yunnan,China[J]. Zoological Research, 1989, 10(1): 1 -8 .
[6] HOU Yi-di,PENG Yan-zhang. A Description of New Species of Trichocephalus (Trichocephalidae,Trichocephalata) From The Golden Monkey,Rhinopithecus Bieti[J]. Zoological Research, 1989, 10(1): 45 -50 .
[7] CHEN Yi,TANG Jue. Studies on Colony structure and Life Cycle of The Spined ant,Polyrhchis Vicina Roger[J]. Zoological Research, 1989, 10(1): 57 -63 .
[8] YANG Da-tong,LI Si-min. A New Species of the Genus Rana From Yunnan[J]. Zoological Research, 1980, 1(2): 261 -264 .
[9] WU Xue-feng,ZHAO Jin-liang,QIAN Ye-zhou,WU Chao. Histological Study of the Digestive System Organogenesis for the Mandarin Fish,Siniperca chuatsi[J]. Zoological Research, 2007, 28(5): 511 -518 .
[10] PAN Ru-liang. Dental Variation Among Asian Colobines, with Specific Reference to the Macaques on the Same Continent[J]. Zoological Research, 2007, 28(6): 569 -579 .